snOPY snoRNA Orthological Gene Database
Homo_sapiens SCARNA12
sequence
CAGGCTGATGAGACTAAGGCGAATGCGACTCCGTGCTCTCTGGCCCTTGGCTCCTTGTT
GGGGGTGGGGACTACAGATGAGATCTGAAATCTTAGTGGTAGTACCTGAGCCATGACTCC
CCACTGTAAGGCCAGATCAATAGCATTGGTGGCCTTGCCTTCATTTCTGGTGCTGCCCCT
AGTTCCTGGCAGCAGCCTGCAGGGAGGCCCACAGGTGGGGTCCACGGTAGGGCTGGGCAC
AAGCCACCTGAGCGCAACCTTGGATCTGACA
  Box motif
  Complementary to target RNA
length 270
organism Homo_sapiens
snoRNA name SCARNA12
alias U89
chromosome ⁄ contig 12
locus ⁄ host gene PHB2
organization Intronic
target RNA U5 snRNA
modification type H/ACA
modification site U5:U46
accession no NR_003010,NT_009759
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved