snOPY snoRNA Orthological Gene Database
Homo_sapiens SCARNA10
sequence
GCCACATGATGATATCAAGGCTGTTGTGATTCAGTTGGTTTGGCTAAGCCCAGGGACCT
TTGGCCTGTTAAAGGTCTGTAATCTTGGTGGGCGATACAGAGTTATGTGTGTTCACTGTA
AGGGCAGACCAACAAGAACTTTTTCCTACTTTTGAGCTACCTCTTTTTAATAGGGGTGAT
TCTTCCAGTTGCTGGAGAGAAATTGTGGTAACTGGAGTGAGAGAGTAGGAACAGGGCATG
TTCAGGGTATCAGGGCCAAGGGTCCTAAAGGACTTAGCTTGTGTTATGGCCACTGAGAGA
TGAAACACAGATCTTTGGTAATCTGATGGCT
  Box motif
  Complementary to target RNA
length 330
organism Homo_sapiens
snoRNA name SCARNA10
alias U85
chromosome ⁄ contig 12
locus ⁄ host gene
organization Intronic
target RNA
modification type H/ACA,C/D
modification site U5:U46,U5:C45
accession no NR_004387,NT_009759
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved