snOPY snoRNA Orthological Gene Database
Homo_sapiens SCARNA5
sequence
AGGTCGATGATGATTGGTAAAAGGTCTGATTGCACTGAATGTCACGGTCCCTTTGTTGC
CCTCAACTCCCAGCAGCCCATTTTTTCCCTCCCGTCACATTTAAGTCATGTGTATGGGAT
CATGGAGCAGCTGATAATTTGGGATTCTGTCAGTGTGTGTTTCTGAGAGTGATCGGCTCA
CAGCTGACGAGTATCCAACAAAACCAGTTACACAGGAGACTGACGAGTGGCAGTCATGGG
TGTGATGGTGCATGATCTCAAGTTTTCAATCTGAGACCT
  Box motif
  Complementary to target RNA
length 278
organism Homo_sapiens
snoRNA name SCARNA5
alias U87
chromosome ⁄ contig 2
locus ⁄ host gene ATG16
organization Intronic
target RNA U5 snRNA, U4 snRNA
modification type C/D
modification site U5:U41,U4:A65
accession no NR_003008 NT_005120
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved