snOPY snoRNA Orthological Gene Database
Homo_sapiens SCARNA17
sequence
AGAGGCTTGGGCCGCCGAGCTGGACCCGGACCGGTTTTGGGTACTGTACTGGGGGCAGG
GCAGAGAGGTGGGCGGCAGTTGGGGTGCGGTGATTGTAGTAGGCTAGGGCGCTTTCGGGT
CCCCATTGCAGCCCCCGGATGAGCCCGCAGTATTTTCCTTATATGATCAGGTCCCATTGC
GGGCGGCGCCGCTTGCCCGGAGCCTGAGAGGATTATGAAAACGTGGCGAGCGAAATGGGG
CCAGGGGACCTGGAGCAGGGGCGTGAGGAGAGTAGGCAGCGGGTGAGGCTGGACGGGAGG
GAGGTCTAGGGAGGCCTCTGCCGCGGGCACTGTGAGTCCTGGCCGATGATGACGAGACCA
CTGCGCAATCTGAGTTCTGGGAACCAGGTGATGGAGTATGTTCTGAGAACAGACTGAGGC
CG
  Box motif
  Complementary to target RNA
length 421
organism Homo_sapiens
snoRNA name SCARNA17
alias U91
chromosome ⁄ contig 18
locus ⁄ host gene SCARNA17
organization Mono
target RNA U4 snRNA, U12 snRNA
modification type C/D
modification site U4:C8,U12:G22
accession no NR_003003 NT_010966
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved