snOPY snoRNA Orthological Gene Database
Homo_sapiens SCARNA1
sequence
CAGCACTTGATACTAACCGAGCTGTCTATATCCTAGCCTTGTGTCAAAGGCTTGTGATG
TGTTGTGATAGCTGGGTTTAAGAAGTGCAATATTAAAACAAAAGCCATGAGTCTTTTAAG
CCCAGTGTGTAAAGATACACTCTGAGTTATAACTCAGAGGCACAACT
  Box motif
  Complementary to target RNA
length 166
organism Homo_sapiens
snoRNA name SCARNA1
alias ACA35
chromosome ⁄ contig 1
locus ⁄ host gene PPP1R8
organization Intronic
target RNA U2 snRNA
modification type H/ACA
modification site U2:U89
accession no NR_002997,NT_004610
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved