snOPY snoRNA Orthological Gene Database
Homo_sapiens SCARNA13
sequence
AATCTGTAGTCTTGGAGCCGCACAGGGTTGGTGGTACCCTCGAGCACACCAGACTTGCA
GAAAAAGCATACTCCAGAGGAAGCTGAGGCATGCCTGCTCGAGAGCCAGCTGTTCCATGT
GCAATTTTCCTCTGATAGTTTCTGGTCACTGTTGCCACGGTGATAATGACTGGGCTATGT
CATTATCTATCCGCCAACAGTAAGAGAAGCTTTGCAGTCGAGATATTGTTTAGCAGATGG
AGTGTTTTCTGTTGAACACTAAGTACTGCCACAAGT
  Box motif
  Complementary to target RNA
length 275
organism Homo_sapiens
snoRNA name SCARNA13
alias U93
chromosome ⁄ contig 14
locus ⁄ host gene SNHG10
organization Intronic
target RNA U2 snRNA, U5 snRNA
modification type H/ACA
modification site U2:U54,U5:U53
accession no NR_003002,NT_026437
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved