snOPY snoRNA Orthological Gene Database
Homo_sapiens SCARNA4
sequence
ACTGGAGGACTAAGAAGGCTGAGTCTGATGAAGTAAGACTTTGCTGATACATTCCTCCT
AGAAAAAAGGGTTGGAGAGAGCAGCCTTCACTGAAGAGTATCACAGGGCTGACTGTACTA
CCCAACACTC
  Box motif
  Complementary to target RNA
length 129
organism Homo_sapiens
snoRNA name SCARNA4
alias ACA26
chromosome ⁄ contig 1
locus ⁄ host gene KIAA0907
organization Intronic
target RNA U2 snRNA
modification type H/ACA
modification site U2:U39,U2:U41
accession no NR_003005 NT_004487
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved