snOPY snoRNA Orthological Gene Database
Homo_sapiens SCARNA15
sequence
CTGGAGACTAAGAAAATAGAGTCCTTGAAATCAAGCTGACTCTGCTTTTAGCCTCCTAA
ATGAAAAGGTAGATAGAACAGGTCTTGTTTGCAAAATAAATTCAAGACCTACTTATCTAC
CAACAGCA
  Box motif
  Complementary to target RNA
length 127
organism Homo_sapiens
snoRNA name SCARNA15
alias ACA45
chromosome ⁄ contig 15
locus ⁄ host gene FSD2 complementary
organization Mono
target RNA U2 snRNA
modification type H/ACA
modification site U2:U37
accession no NR_003011,NT_077661
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved