snOPY snoRNA Orthological Gene Database
Homo_sapiens SCARNA8
sequence
TGGGAGGCTGATACACAAATTGGGCTGAAATACTGCTCTACTTGTCACCATGCCTCCCT
AGAATAAACTGCCTTTTGATGACCGGGACGAATTGAGTGAAATCGTAACGGACAGATACG
GGGCAGACAGAT
  Box motif
  Complementary to target RNA
length 131
organism Homo_sapiens
snoRNA name SCARNA8
alias U92
chromosome ⁄ contig 9
locus ⁄ host gene FAM29A
organization Intronic
target RNA U2 snRNA
modification type H/ACA
modification site U2:U34,U2:U44
accession no NR_003009 NT_008413
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved