snOPY snoRNA Orthological Gene Database
Homo_sapiens SCARNA2
sequence
GTTTTAGGGAGGGAGAGCGGCCTGGGTCCTGGGTGTTGTGTGCGGAGCTGTGGCGTCGC
GTGTGAGGCGCGTGCAGGGTGAGTGTGAGTGGACGCGTGAGTGTGTGAGTGTGCGCGCTT
GGAGCGTGTTAGGCGAGTGCGTGCGCCCACCCCTGCGCCCCTCCTCCCGCTTACACTTTG
ATCTTATTTGATCGGATCGTGACCCCAGCCCCGCCGGGCCGACCCGAAATGAAAAGCTCT
CCTCCTGCGAAGCCCCCTCGGGGCGCTGTGCAGCGAGGCCCCTTAGGCGGCGGCCACGCT
GTGGTCCCCGAGGTCCCGGAGCTGGCCCTGCGGGGCCCGGCGCTCAGAAGTGATGAATTG
ATCAGATAGACGAGGCCGGGCTTGTCCCCGGCCACTGATTATCGAGGCGATTCTGATCTG
G
  Box motif
  Complementary to target RNA
length 420
organism Homo_sapiens
snoRNA name SCARNA2
alias mgU2-25/61
chromosome ⁄ contig 1
locus ⁄ host gene
organization Mono
target RNA
modification type C/D
modification site U2:G11,U2:G25,U2:C61
accession no NR_003023 NT_032977
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved