snOPY snoRNA Orthological Gene Database
Homo_sapiens SCARNA14
sequence
GTGACTGTTCCTGGTATTGATTGCATTTGTTAGTTGTACAGTGCAACCATAGACAGTCA
CACACATTAAAACAGATGGTTCCTGCCGACAGGGTCTGTATAGTTATCAGATTTTCTGTG
CGATGGCTCCATACATGT
  Box motif
  Complementary to target RNA
length 137
organism Homo_sapiens
snoRNA name SCARNA14
alias U100
chromosome ⁄ contig
locus ⁄ host gene TIPIN
organization Intronic
target RNA U2 snRNA
modification type H/ACA
modification site U2:U7
accession no AY349601,NT_010194
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved