snOPY snoRNA Orthological Gene Database
Homo_sapiens SCARNA7
sequence
TGGAAATGATGAAATAGAGATAATTGGGTGTTGAATGTTGTATGACTGGAAATTTTTAA
TATGTATATTATGTAATTCTTATAAGTTTAGTGTTTTATAGGTACTTAATAGAGAGTGTG
TATGCATGTGTGTGTGCTTGTGGTGGCTATGGAAAGGGGGCACTGACTGGTGATGCTGAT
ATTGGAGTGCATCTGAGGCTGTTGTAGAAATAACATGGGTTGTTGATTACAACATTGCCA
ATGATTATAACCCAAGAACAGCTCACCTAACTAGCCTGGCACCCTAAAATCTCTAACAGG
TTCATTAAAATGGTCCTGTGATCTGATCCAA
  Box motif
  Complementary to target RNA
length 330
organism Homo_sapiens
snoRNA name SCARNA7
alias U90
chromosome ⁄ contig 3
locus ⁄ host gene
organization Intronic
target RNA
modification type C/D
modification site U1:A70
accession no NR_003001NT_005612
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved