snOPY snoRNA Orthological Gene Database
Homo_sapiens SCARNA18
sequence
TTGCATGTGGAAATGTCTGCTTCTCATTCCTTGGGAGCAGGAATATGTTCATAACATGC
TACATTAACAAAGGAGTTCTCAGGGCTGCCAACCTTCTAGTAAAGGTTGAGTGGTAGTAT
ATTTCTCCAACATAA
  Box motif
  Complementary to target RNA
length 134
organism Homo_sapiens
snoRNA name SCARNA18
alias U109
chromosome ⁄ contig 5
locus ⁄ host gene TMEM167A
organization Intronic
target RNA U1 snRNA
modification type H/ACA
modification site U1:U6
accession no NR_003139 NT_006713
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved