snOPY snoRNA Orthological Gene Database
Homo_sapiens SCARNA16
sequence
ACGGTCTGGGGAAAGGCTCCTGTGTTGTTGAGCCTGCCAAGTTGTGGGTGCAGCATGGT
ACCAGGCAGCCCAACCCTGACCTAAAGTAAATTCCCGGAAGAAGTCTTTCCTGGGTTTTG
AATTTGCAGTAACAGGTGTGAGCATTCTAGCAGCAGTTTGATGATCATGTATGATACTGC
AAACAGGA
  Box motif
  Complementary to target RNA
length 187
organism Homo_sapiens
snoRNA name SCARNA16
alias ACA47
chromosome ⁄ contig 16
locus ⁄ host gene
organization Intronic
target RNA
modification type H/ACA
modification site U1:U5
accession no AJ609486 NT_010783
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved