snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD127
sequence
TGGCAACTGTGATGAAAGATTTGGTCTGTATGTAATAGATTTTATTACTAAATGAGGAC
AACAGTCCCTCTAAACTGATGTTGCCA
  Box motif
  Complementary to target RNA
length 86
organism Homo_sapiens
snoRNA name SNORD127
alias
chromosome ⁄ contig 14
locus ⁄ host gene PRPF39
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site 18S:G1447
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved