snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD105B
sequence
CCACATGCGGCTGATGACAGCACTTCTGCTGAGACGCTGTGATTGCTCTGTCCAAAGTA
AACGCCCTGACGCACTGTGG
  Box motif
  Complementary to target RNA
length 79
organism Homo_sapiens
snoRNA name SNORD105B
alias U105B
chromosome ⁄ contig 19
locus ⁄ host gene P2RY11
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site 18S:U799
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved