snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD11B
sequence
TGATGGCAATGATGATTTTTACACTTATTGTTGTTCACCTGATAACATAAATATGAGGG
TGTTCAGTCACTACCTCATCTGATGCCATCA
  Box motif
  Complementary to target RNA
length 90
organism Homo_sapiens
snoRNA name SNORD11B
alias HBII-95B
chromosome ⁄ contig
locus ⁄ host gene NOP5/NOP58
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site 18S:G509
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved