snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA36B
sequence
TTCCAAAGTGTTAAGTTCAGTTCAGGGTAGCTTCCCTGCTCTGTTAATTAAACTTTGGA
ACATTGAAACTGGCTAGGGAAAATGATTGGATAGAAACTATTATTCTATTCATTTATCCC
CAGCCTACAAAA
  Box motif
  Complementary to target RNA
length 131
organism Homo_sapiens
snoRNA name SNORA36B
alias ACA36B
chromosome ⁄ contig 1
locus ⁄ host gene RAB3-GAP150
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U105,18S:U1244
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved