snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD119
sequence
GCTGGATTAATGATGAGATATAACCTTGACTGAAGCTGATGATGAGTTTGTATAATTAA
GCAGGATTACTCTGAGATCCAGC
  Box motif
  Complementary to target RNA
length 82
organism Homo_sapiens
snoRNA name SNORD119
alias
chromosome ⁄ contig 20
locus ⁄ host gene SNRPB
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:A4560
accession no NR_003684,NT_011387
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved