snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA78
sequence
GTTGGTTGAAAATCGCCCCCGGCTTTGGCCGTGGCCGCGGGTGAGATTCGGCGCCCAGA
GCCCCCGGGGGCCTCAGCTCACCGCGCGCTGCCCCATGTGCGGCGGTGAAACCCAGGCCC
CGACAGGC
  Box motif
  Complementary to target RNA
length 127
organism Homo_sapiens
snoRNA name SNORA78
alias ACA64
chromosome ⁄ contig 16
locus ⁄ host gene
organization Intronic
target RNA
modification type H/ACA
modification site 28S:U4331
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved