snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA34
sequence
GTGGCCCTGACTGAAGACCAGCAGTTGTACTGTGGCTGTTGGTTTCAAGCAGAGGCCTA
AAGGACTGTCTTCCTGTGGTCTGTTGGCTGTTCTGGGACCTCAGTAGGGAATGGCTATTT
CATTTGGAAGAAACAACC
  Box motif
  Complementary to target RNA
length 137
organism Homo_sapiens
snoRNA name SNORA34
alias ACA34
chromosome ⁄ contig 12
locus ⁄ host gene C12orf41
organization Intronic
target RNA 28S rRNA
modification type H/ACA
modification site 28S:U4269,28S:U4282
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved