snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD12B
sequence
GCTGGCATATATGATGACTTAGCTTTTTTCCCCGACAGATCGACTATGTTGATCTAACT
TTTCTAAGCCAGTTTCTGTCTGATATGCCAGC
  Box motif
  Complementary to target RNA
length 91
organism Homo_sapiens
snoRNA name SNORD12B
alias HBII-99B
chromosome ⁄ contig 20
locus ⁄ host gene C20orf199
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:G3878
accession no
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved