snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD10
sequence
GCTCTGTGATGGAGCCCATGCGTGTCATCTGAGCCTCTGGCTTCCCTGCCAGTGCAGCC
CTGGCAGTGTCCTACTTCCCAGGGCTGTTGTCTGCCTGGCGGGAAGGTCCTGGGCAAAGG
ATCAGTCTTTGTACTCTGAGAGCAGACTA
  Box motif
  Complementary to target RNA
length 148
organism Homo_sapiens
snoRNA name SNORD10
alias mgU6-77
chromosome ⁄ contig
locus ⁄ host gene EIF4A1
organization Intronic
target RNA 28S rRNA, U6 snRNA
modification type unknown
modification site U6 snRNA:C77,28S:C3787
accession no NR_002604
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved