snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD54
sequence
TGGCGATGAGGAGGTACCTATTGTGTTGAGTAACGGTGATAATTTTATACGCTATTCTG
AGCC
  Box motif
  Complementary to target RNA
length 63
organism Homo_sapiens
snoRNA name SNORD54
alias U54
chromosome ⁄ contig 8
locus ⁄ host gene RPS20
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site 18S:G644
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved