snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD5
sequence
GTTCAGATGATGAATTTAACTGTTCAACTGCTGAATGATAACGGGCATGAACTAAAACT
TAATTCTGACAGAG
  Box motif
  Complementary to target RNA
length 73
organism Homo_sapiens
snoRNA name SNORD5
alias mgh28S-2409
chromosome ⁄ contig 17
locus ⁄ host gene JOSD3
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:C2409
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved