snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA47
sequence
TGGAGGACTGAGAAGGTGAGGCAGTTTTGCCCCGTGCTGCCTTCCACCGGTTAAGACCT
CCAAAATCGAAGGGCTGCCCAGGCAGAGGATGTCCCCTTGCCACCCTTGGAGGGGCAGCG
CTGTGCTGGCCGACATTTG
  Box motif
  Complementary to target RNA
length 138
organism Homo_sapiens
snoRNA name SNORA47
alias HBI-115
chromosome ⁄ contig
locus ⁄ host gene mono:SNORA47test
organization Intronic
target RNA 28S rRNA
modification type H/ACA
modification site 28S:U1766
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved