snOPY snoRNA Orthological Gene Database
Homo_sapiens AP000818.4
sequence
TTTAATGATGAGAACATGGACCAAGTACAAATTAGTTGAAAACCTATGGCGCTGAATGA
TGAATTGATTTCAAACATGAAACAGATTTTTAGA
  Box motif
  Complementary to target RNA
length 93
organism Homo_sapiens
snoRNA name AP000818.4
alias
chromosome ⁄ contig 11
locus ⁄ host gene LOH11CR2A
organization Intronic
target RNA
modification type unknown
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved