snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD14AL2
sequence
TCGCTGTGATGAGTGATTGTTAAACATTCGTAGTTTCCACCAAAAGCTTGGCTAATGAT
GGCAACACCTTCCTTGGATGTCTGAGCGA
  Box motif
  Complementary to target RNA
length 88
organism Homo_sapiens
snoRNA name SNORD14AL2
alias
chromosome ⁄ contig 11
locus ⁄ host gene HSPA8
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved