snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA40
sequence
TGCACTTATGTATGTTTTTGTTTAACGTGGACAAAGACTTACAGATAGGTGCAAAAAAT
AAATCCTCTTTTGCAACCCAGAACTCATTGTTCAGTATGAGTTTTGATACATATAAGAAG
GGATATTA
  Box motif
  Complementary to target RNA
length 127
organism Homo_sapiens
snoRNA name SNORA40
alias ACA40
chromosome ⁄ contig 11
locus ⁄ host gene JOSD3
organization Intronic
target RNA 18S rRNA, 28S rRNA
modification type H/ACA
modification site 28S:U4546,18S:U1174
accession no AJ609445 NT_167190
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved