snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA18
sequence
GTTGAGGTCTATCCCGATGGGGCTTTTCCTGTAGCCTGCACATCGTTGGAAACGCCTCA
TAGAGTAACTCTGTGGTTTTACTTTACTCACAGGACTATTGTTAGATCTGTGGGAAGGAA
TTACAAGACAGTT
  Box motif
  Complementary to target RNA
length 132
organism Homo_sapiens
snoRNA name SNORA18
alias ACA18
chromosome ⁄ contig 11
locus ⁄ host gene
organization Intronic
target RNA
modification type H/ACA
modification site
accession no NR_002959 NT_167190
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved