snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA8
sequence
TGCACTGCATGGTATCTGCACTCAGCAGTTTACACCTGCTAGGGTGTTCAAAGGTCAGT
GCTATAGAAATTCAGTATCTGGCATCGTTGGTTTTCTTGGCTTTGTGCTTGTTAAACCTG
GTATTTCTACTGATACAGTA
  Box motif
  Complementary to target RNA
length 139
organism Homo_sapiens
snoRNA name SNORA8
alias ACA8
chromosome ⁄ contig 11
locus ⁄ host gene JOSD3
organization Intronic
target RNA 18S rRNA, 28S rRNA
modification type H/ACA
modification site 18S:U1056,18S:U1081,28S:U3832
accession no NR_002920,NT_167190
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved