snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA32
sequence
TGGTCATTACCAAGGCTTTTAGAATGCAGTTTCTCATTTGCTGTGGACATGACCATAAA
AAAATTTCCCAGTAGGTTTTCTATCTGCTACTTTGCTAGCAATCAGCTTATTGGGAACAG
TT
  Box motif
  Complementary to target RNA
length 121
organism Homo_sapiens
snoRNA name SNORA32
alias ACA32
chromosome ⁄ contig 11
locus ⁄ host gene
organization Intronic
target RNA
modification type H/ACA
modification site 28S:U1847
accession no NR_003032 NT_167190
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved