snOPY snoRNA Orthological Gene Database
Homo_sapiens SCARNA9
sequence
GGGCAATGATGAAAAGGTTTTACTACTGATCTTTGTAACTATGATGGTTTCTACACTTG
ACCTGAGCTCA
  Box motif
  Complementary to target RNA
length 70
organism Homo_sapiens
snoRNA name SCARNA9
alias mgU2-19/30,Z32
chromosome ⁄ contig 11
locus ⁄ host gene KIAA1731
organization Intronic
target RNA U2 snRNA
modification type C/D
modification site U2:G19,U2:A30
accession no
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved