snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD15A
sequence
CTTCGATGAAGAGATGATGACGAGTCTGACTTGGGGATGTTCTCTTTGCCCAGGTGGCC
TACTCTGTGCTGCGTTCTGTGGCACAGTTTAAAGAGCCCTGGTTGAAGTAATTTCCTAAA
GATGACTTAGAGGCATTTGTCTGAGAAGG
  Box motif
  Complementary to target RNA
length 148
organism Homo_sapiens
snoRNA name SNORD15A
alias U15A
chromosome ⁄ contig 11
locus ⁄ host gene RPS3
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:A3764
accession no NR_000005,NT_167190
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved