snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD43L1
sequence
ACAGATGATGAACTCATTGACAGACATACAGAGACTGTGTGCTGATTGTCATGTTCTGA
CTTA
  Box motif
  Complementary to target RNA
length 63
organism Homo_sapiens
snoRNA name SNORD43L1
alias
chromosome ⁄ contig 11
locus ⁄ host gene CHRDL2
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved