snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA57
sequence
CCTCCTTTTCTTGGCGGGGATCGGGCTTGTGGTGCCGCTCCCCGTAATGTACGGAGGAA
GAGGGAAAGGGCTCTGGCCCCCTCGGCGTCATGTCTTCGGTGCTGGCGGCTTCCCATCCG
CTGGTTCTATCCTCAAACGCCGGGACACCG
  Box motif
  Complementary to target RNA
length 149
organism Homo_sapiens
snoRNA name SNORA57
alias U99
chromosome ⁄ contig 11
locus ⁄ host gene
organization Intronic
target RNA
modification type H/ACA
modification site 18S:U1004
accession no AY349600 NT_167190
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved