snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD67
sequence
TGTGAGAGTGATGAGTTGCACACTGGTGGAGCCATGGTATCAGGTGATACAGGCACCAC
TCAGTATCACCCTGGTGACAAAATCAAGTGCACAGGGGCCATCTGACTCACA
  Box motif
  Complementary to target RNA
length 111
organism Homo_sapiens
snoRNA name SNORD67
alias HBII-166
chromosome ⁄ contig 11
locus ⁄ host gene CKAP5
organization Intronic
target RNA U6 snRNA
modification type C/D
modification site U6:C60
accession no NR_003056,NT_009237
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved