snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA23
sequence
CATGGCTGCTGTAATGTGTGCATAGGTTTCATCTGTGTCTGGTAGCAGTGTCTGTCTGT
GTTTTTCATTCAGATCTTGCTATCCACACAAACATCATGCGGCCAAAGAGTAACTTGGGA
TCATAGTACTGGTCTAGTGTTGTCTCTGGACACATCTACCACTGGCCAGCCTCCAAATTC
CCACACACAG
  Box motif
  Complementary to target RNA
length 189
organism Homo_sapiens
snoRNA name SNORA23
alias ACA23
chromosome ⁄ contig 11
locus ⁄ host gene IPO7
organization Intronic
target RNA 28S rRNA
modification type H/ACA
modification site 28S:U3737,28S:U4331
accession no AJ609438 NT_009237
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved