snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA45
sequence
GCCGAGACTAGAGTCACATCCTGACACAACTCTTGTCCTGGTGTGCTAGAGTACTCGAA
GAGAATCTACTGGTCTTGATTCACTGGTGGGGGCAGTCGGTGCCCCCGTTAGTGCCCAGA
TCAGAAACATAC
  Box motif
  Complementary to target RNA
length 131
organism Homo_sapiens
snoRNA name SNORA45
alias ACA3-2
chromosome ⁄ contig 11
locus ⁄ host gene
organization Intronic
target RNA
modification type H/ACA
modification site 28S:U3899
accession no AM055744 NT_009237
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved