snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA3
sequence
ATCGAGGCTAGAGTCACGCTTGGGTATCGGCTATTGCCTGAGTGTGCTAGAGTCCTCGA
AGAGTAACTGCTGACCTTATTCACTGGCTGTGGGCCTTATGGCACAGTCAGTCACCAGGT
TAGAGACATGC
  Box motif
  Complementary to target RNA
length 130
organism Homo_sapiens
snoRNA name SNORA3
alias ACA3
chromosome ⁄ contig 11
locus ⁄ host gene RPL27A
organization Intronic
target RNA 28S rRNA
modification type H/ACA
modification site 28S:U3899,28S:U3938
accession no AJ609428 NT_009237
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved