snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA54
sequence
GAGCACTGTTCGTAACCCGTTAGCCTGGCTGTAGCTAATGGGTTCCATTCCGGTGCAAT
AGCATTTCCAGCGACACATGACTGACTGACTGGTGGCTTTCAGTTTCAGGTCTTGGAGAC
AAAT
  Box motif
  Complementary to target RNA
length 123
organism Homo_sapiens
snoRNA name SNORA54
alias ACA54
chromosome ⁄ contig 11
locus ⁄ host gene
organization Intronic
target RNA
modification type H/ACA
modification site 28S:U3801,28S:U4539
accession no AJ609479 NT_009237
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved