snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA52
sequence
TGGTCCATCCTAATCCCTGCCGGTCCATCTGTGGCCTGCCAGGTTTCGCTTGTGGACCA
GAGCACCCTAGAAGCCTCACCCGAGGAGTGAGCAGGGCTCCAGTGGGCTCACGTCATGGG
CACTTCTAGACACTC
  Box motif
  Complementary to target RNA
length 134
organism Homo_sapiens
snoRNA name SNORA52
alias ACA52
chromosome ⁄ contig 11
locus ⁄ host gene RPLP2
organization Intronic
target RNA 28S rRNA
modification type H/ACA
modification site 28S:U1731
accession no AJ609448 NT_009237
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved