snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA80
sequence
GCATGGGTTTGGATTTATGATGGGCCCGTCCCCCTGGACCTCTCATAGTACCCCATGCC
AGAGCAAACTGTAGCCCTGAACCATTGCCTGGCCTCTGTTCCCGTAGGCTGCTGGCACTG
AAGTGGGTTGCACAATA
  Box motif
  Complementary to target RNA
length 136
organism Homo_sapiens
snoRNA name SNORA80
alias ACA67
chromosome ⁄ contig 21
locus ⁄ host gene URB1.
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U109,18S:U572
accession no NR_002996,NT_011512
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved