snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA72
sequence
CTGCGAATATTCTCGCTGTTCTGATTTTGTAATAGTCAGGACAGGCTAAACATTCGCTA
TATTAAGACCATGCATGTGTCCCCAAACCTAGTTCTTTCCCTAGGTCTGGTTTTATAAAT
GCTGGTGATAAAC
  Box motif
  Complementary to target RNA
length 132
organism Homo_sapiens
snoRNA name SNORA72
alias U72
chromosome ⁄ contig 8
locus ⁄ host gene RPL30
organization Intronic
target RNA 5.8S rRNA
modification type H/ACA
modification site 5.8S:U55
accession no Y11167,NT_008046
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved