snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA28
sequence
AAGCAACACTCTGTGGCAGATGATCAAAACTGTCTGACACAATTTGAGCTTGCTATAGC
AAGAAAGTCTAACCTATTCCGGTGTTCTCTCTCCCATGAGACAAGCCGTTATATAGACTT
AAACAGT
  Box motif
  Complementary to target RNA
length 126
organism Homo_sapiens
snoRNA name SNORA28
alias ACA28
chromosome ⁄ contig 14
locus ⁄ host gene EIF5
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U815,18S:U866
accession no AJ609462 NT_026437
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved