snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD3@
sequence
AAAATTATACTTTCAGCAATCATCTCTATAGTTTGTTACTAGAGAAGCTTCTGTGAATG
TGTAGAGCACCGGAAACCACAAGGCAAAGGCTCAGCATTCTCTCCTAAGCGCGAAGCTGG
CTCCTGGTGTTGGTTGGCCGCAACTGCCATTTGCCATTGATGATCATTCTTCTCTTCCTG
TGGTAGAGGAAGAGGGAGAGAATGCAGTTTGAGTGG
  Box motif
  Complementary to target RNA
length 215
organism Homo_sapiens
snoRNA name SNORD3@
alias
chromosome ⁄ contig 14
locus ⁄ host gene CATSPERB
organization Intronic
target RNA Unknown
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved