snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA11B
sequence
GGGGTGTGCTCAGAGCAGGGGGCCCGAAGAATGCCTCCTCTGTTTACAACACACCCAAT
AGGAATCTGGGGTCATTGTGACAAGGGACACAGAGCTTGTGACCTCCCTACAAACAAATG
CCCTACACAT
  Box motif
  Complementary to target RNA
length 129
organism Homo_sapiens
snoRNA name SNORA11B
alias U107E
chromosome ⁄ contig 14
locus ⁄ host gene C14orf159
organization Intronic
target RNA Unknown
modification type H/ACA
modification site
accession no NR_002604
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved