snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA79
sequence
TGATGACTGTTCTTCCTGTTGCCTTCAGACCTGGCATTAGGATTTTAGGTCATCATAAA
TTAAAATTTGATTTTCTTCACTCAGAGAATATTAGGATAATGGAGTTATCTGTTCTCTGA
AATTTGCGGAATCAAACATGT
  Box motif
  Complementary to target RNA
length 140
organism Homo_sapiens
snoRNA name SNORA79
alias ACA65
chromosome ⁄ contig 14
locus ⁄ host gene
organization Intronic
target RNA
modification type H/ACA
modification site U6:U31,U6:U86
accession no NR_003021,NT_026437
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved