snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA70F
sequence
CTGCAGCTAGTTAACCTGACTTGTCCACCTCCCTGCTGGGGGCTCAGTGTGCAATGGTT
GCAAAATGGAGATTCCCTGGTTGTGTATACACCTCATTTCTTGAATGTGTTGCTTTAAGG
GTTCTTGAAGACATTA
  Box motif
  Complementary to target RNA
length 135
organism Homo_sapiens
snoRNA name SNORA70F
alias
chromosome ⁄ contig 14
locus ⁄ host gene TXNDC1
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U1692
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved