snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD8
sequence
TCCCAATGATGAGTTGCCATGCTAATACTGAGCCACCAGGTAGGGCAGTGTTGCCCTGG
TTTGGGTGCCAGTGAGTTTAACAAAACTTCTCACATGAAGATCTGAGGGG
  Box motif
  Complementary to target RNA
length 109
organism Homo_sapiens
snoRNA name SNORD8
alias mgU6-53
chromosome ⁄ contig 14
locus ⁄ host gene CHD8
organization Intronic
target RNA U6 snRNA
modification type C/D
modification site U6:A53
accession no AJ243222,NT_026437
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved